Bicinchoninic Acid Protein Assay:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Staining:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Multiplex Assay:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Article Title: Structure of the MIWI endoribonuclease bound to pachytene piRNAs from mouse testes.
Article Snippet: Cas9 Nuclease V3 IDT Cat. No. 1081058 IDTE pH 7.5 (1× TE Solution) IDT Cat. No. 11-05-01-05 PierceTM Protease Inhibitor Tablets, EDTAfree Thermo Fisher Cat. no. A32965 OCT Embedding Matrix for Frozen Section VWR Cat. no. 361603E RiboLock RNase Inhibitor Thermo Fisher Cat. no. EO0381 Chloroform Merck Cat. no. 102445 (Continued on next page) 14 Cell Reports 45, 116804, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER GeneRuler 1kb DNA ladder Thermo Fisher Cat. no. SM0311 GlycoBlueTM Coprecipitant Thermo Fisher Cat. no. AM9515 Amersham Protran 0.45 mm Nitrocellulose Membrane GE Healthcare Cat. no. 10600002 Amersham Hyperfilm ECL GE Healthcare Cat. no. 28906837 Critical Commercial Assays/Kits NEBNext® Multiplex Small RNA Library Prep Set for Illumina® NEB Cat. No. E7300 MinElute Gel Extraction Kit Qiagen Cat. No. 28604 QIAquick PCR Purification Kit Qiagen Cat. No. 28106 Illustra MicroSpin G-25 micro columns, GE Healthcare Cat. No. 27-5325-01 Allprep DNA/RNA Micro Kit Qiagen Cat. No. 80284 MEGAshortscriptTM T7 Transcription Kit Life technologies Cat. no. AM1354 Deposited Data All raw gel and imaging data are deposited at Mendeley Data. .. This study Mendeley Data: https://doi.org/10.17632/ 3grbh5s2zh.1 Mass spectrometry data This study See Table S2 PRIDE: PXD071431 Deep sequencing datasets This study.
Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
Crocin Bleaching Assay:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Reverse Transcription:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Gel Extraction:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Article Title: Structure of the MIWI endoribonuclease bound to pachytene piRNAs from mouse testes.
Article Snippet: Cas9 Nuclease V3 IDT Cat. No. 1081058 IDTE pH 7.5 (1× TE Solution) IDT Cat. No. 11-05-01-05 PierceTM Protease Inhibitor Tablets, EDTAfree Thermo Fisher Cat. no. A32965 OCT Embedding Matrix for Frozen Section VWR Cat. no. 361603E RiboLock RNase Inhibitor Thermo Fisher Cat. no. EO0381 Chloroform Merck Cat. no. 102445 (Continued on next page) 14 Cell Reports 45, 116804, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER GeneRuler 1kb DNA ladder Thermo Fisher Cat. no. SM0311 GlycoBlueTM Coprecipitant Thermo Fisher Cat. no. AM9515 Amersham Protran 0.45 mm Nitrocellulose Membrane GE Healthcare Cat. no. 10600002 Amersham Hyperfilm ECL GE Healthcare Cat. no. 28906837 Critical Commercial Assays/Kits NEBNext® Multiplex Small RNA Library Prep Set for Illumina® NEB Cat. No. E7300 MinElute Gel Extraction Kit Qiagen Cat. No. 28604 QIAquick PCR Purification Kit Qiagen Cat. No. 28106 Illustra MicroSpin G-25 micro columns, GE Healthcare Cat. No. 27-5325-01 Allprep DNA/RNA Micro Kit Qiagen Cat. No. 80284 MEGAshortscriptTM T7 Transcription Kit Life technologies Cat. no. AM1354 Deposited Data All raw gel and imaging data are deposited at Mendeley Data. .. This study Mendeley Data: https://doi.org/10.17632/ 3grbh5s2zh.1 Mass spectrometry data This study See Table S2 PRIDE: PXD071431 Deep sequencing datasets This study.
Sequencing:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Transgenic Assay:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Immunopeptidomics:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Polymerase Chain Reaction:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Article Title: Structure of the MIWI endoribonuclease bound to pachytene piRNAs from mouse testes.
Article Snippet: Cas9 Nuclease V3 IDT Cat. No. 1081058 IDTE pH 7.5 (1× TE Solution) IDT Cat. No. 11-05-01-05 PierceTM Protease Inhibitor Tablets, EDTAfree Thermo Fisher Cat. no. A32965 OCT Embedding Matrix for Frozen Section VWR Cat. no. 361603E RiboLock RNase Inhibitor Thermo Fisher Cat. no. EO0381 Chloroform Merck Cat. no. 102445 (Continued on next page) 14 Cell Reports 45, 116804, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER GeneRuler 1kb DNA ladder Thermo Fisher Cat. no. SM0311 GlycoBlueTM Coprecipitant Thermo Fisher Cat. no. AM9515 Amersham Protran 0.45 mm Nitrocellulose Membrane GE Healthcare Cat. no. 10600002 Amersham Hyperfilm ECL GE Healthcare Cat. no. 28906837 Critical Commercial Assays/Kits NEBNext® Multiplex Small RNA Library Prep Set for Illumina® NEB Cat. No. E7300 MinElute Gel Extraction Kit Qiagen Cat. No. 28604 QIAquick PCR Purification Kit Qiagen Cat. No. 28106 Illustra MicroSpin G-25 micro columns, GE Healthcare Cat. No. 27-5325-01 Allprep DNA/RNA Micro Kit Qiagen Cat. No. 80284 MEGAshortscriptTM T7 Transcription Kit Life technologies Cat. no. AM1354 Deposited Data All raw gel and imaging data are deposited at Mendeley Data. .. This study Mendeley Data: https://doi.org/10.17632/ 3grbh5s2zh.1 Mass spectrometry data This study See Table S2 PRIDE: PXD071431 Deep sequencing datasets This study.
Recombinant:Article Title: Multivalent nanoparticles activate T-dependent antibody response via antigen presentation by both B cells and dendritic cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER PierceTM BCA Protein Assay Kit Thermo Fisher Scientific Cat23227 Foxp3/Transcription Factor Staining Buffer Set Invitrogen Cat#00-5523-00 Quant-iTTM RiboGreenTM RNA Assay Kit Invitrogen Cat#R11490 Ni-NTA 6FF (Pre-Packed Gravity Column) BBI Life Sciences Cat#C600793-0005 Mouse 11 Cytokines Multiplex Assay Kit (CBA) absin Cat#abs50187 SMARTScribeTM Reverse Transcriptase Takara Cat#639536 PrimeSTAR® Max DNA Polymerase Ver.2 Takara Cat#R047 DNA Gel Extraction Kit Huateng Biotechnology Co., Ltd Cat#H145-04 Ligase-based Barcoding Kit Polyseq Cat#PY-DLB101 Universal Library Prep Kit Polyseq Cat#PY-BLP101 PolyseqOne nanopore sequencer Polyseq https://www.polyseq. com/products PolyseqCell sequencing chip Polyseq Cat#PY-NFC001 Experimental models: Cell lines Expi293F GIBCO Cat# A14635 Experimental models: Organisms/strains C57BL/6 Institute of Biophysics, Chinese Academy of Sciences N/A OT-II TCR transgenic mouse Barnden et al.62 N/A MyD88fl/fl Cd79a-cre mouse Hou et al.30 N/A CD11c-DTR mouse Jung et al.40 N/A μMT mouse Kitamura et al.63 N/A MHC II−/- mouse Madsen et al.64 N/A MD4 BCR transgenic mouse Goodnow et al.65 N/A Oligonucleotides Primer for IGHV template switching and UMI incorporation: AGTCGGTAGGATA GCGAGTACArUNNNNrUNNNNrUNNNNTCTT(rG)5 This paper N/A Primer for IGMHV 3′ reverse-transcription: TTTTGCATACCAGGTATT This paper N/A Primer for IGGHV 3′ reverse-transcription: TGYTSGAGGKKACAGTCA This paper N/A Primer for IGHV 1st and 2ND PCR Forward: CACTCTGTCCGTCAGTCGGTAGGATAGCGAGTA This paper N/A Primer for IgM 1st PCR Reverse: AGGTTCTGATACCCTGGATGAC This paper N/A Primer for IgG 1st PCR Reverse: CTGGACAGGGMTCCAKAGTTCCA This paper N/A Primer for IgM 2ND PCR Reverse: ATGACTTCAGTGTTGTTCTGGT This paper N/A Primer for IgG 2ND PCR Reverse: GTYACYGRCTCAGGGAA This paper N/A Recombinant DNA pET28a-AP205-SpyTag Guo et al.38 N/A pCEP4-RBD Guo et al.38 N/A pCEP4-RBD-SpyCatcher Guo et al.38 N/A pCEP4-RBD-AviTag Guo et al.38 N/A pCEP4-RBDOVA-SpyCatcher This paper N/A (Continued on next page) 20 Cell Reports 45, 117332, May 26, 2026 ..
Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Marker:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Magnetic Cell Separation:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Isolation:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Qubit Protein Assay:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Cloning:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Plasmid Preparation:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
RNAscope:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Knock-Out:Article Title: Dysregulation of astrocyte-secreted pleiotrophin contributes to neuronal structural and functional deficits in Down syndrome.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glutamax Life Technologies Cat# 35050-061 Sodium Pyruvate Life Technologies Cat# 11360-070 N-acetyl-L-cysteine Sigma Cat# A8199 Transferrin Sigma Cat#T1147 Bovine albumin Sigma Cat# A4161 Bovine albumin Sigma Cat# A2153 Progesterone Sigma Cat# P6149 Progesterone Sigma Cat# P8783 Putrescine Sigma Cat# P5780 Sodium selenite Sigma Cat# S9133 Recombinant Heparin binding EGF like growth factor R&D Systems Cat# 259-HE/CF Dulbecco’s Phosphate Buffered Saline Hyclone Cat# SH30264.01 Laminin R&D Systems Cat# 3400-010-01 Insulin Sigma Cat# I6634 Triiodo-thyronine Sigma Cat# T6397 Forskolin Sigma Cat# F6886 Recombinant human pleiotrophin R&D Systems Cat# 252-LP-050 L-carnitine hydrochloride Sigma Cat# C0283 Ethanolamine Sigma Cat# E9508 D(+)-galactose Sigma Cat# G0625 Putrescine Sigma Cat# P5780 Corticosterone Sigma Cat# C2505 Linoleic acid Sigma Cat# L1012 Lipoic acid Sigma Cat# T1395 Retinyl acetate Sigma Cat# R7882 Retinol Sigma Cat# 95144 D,L-alpha tocopherol acetate Sigma Cat# T3001 Catalase Sigma Cat# C40 Glutathione Sigma Cat# G6013 Superoxide dismutase Sigma Cat# S5395 Transferrin Sigma Cat# T5391 Paraformaldehyde Electron Microscopy Sciences Cat# 19208 Paraformaldehyde Electron Microscopy Sciences Cat# 50980487 Sodium chloride Sigma Cat# S5886 Trizma base Sigma Cat# T6066 L-lysine Sigma Cat# L5501 Triton X-100 Sigma Cat# T9284 4 ′ ,6-diamidino-2-phenylindole Thermo Fisher Scientific Cat# 62247 MOPS SDS running buffer Invitrogen Cat# B0001.02 Tris Glycine buffer Thermo Fisher Scientific Cat# 28363 Methanol Fisher Cat# A412-4 Casein buffer BioRad Cat# 1610782 Tris-buffered saline BioRad Cat# 105300272 Tween 20 Sigma Cat# P9416 NheI New England Biolabs Cat# R3131S XbaI New England Biolabs Cat# R0145S Carbenicillin Teknova Cat# C2130 Ketamine Victor Medical Company Cat# 1699053 (Continued on next page) Cell Reports 44, 116300, October 28, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Xylazine Victor Medical Company Cat# 1264078 Sucrose Invitrogen Cat# 1503-022 Hydrogen peroxide Millipore Sigma Cat# H3410 TAE684 Santa Cruz Biotechnology Cat# sc-364626; CAS 761439-42-3 2,2,2-Tribromomoethanol (Avertin) TCI Cat# T1420 Tert-Amyl Alcohol TCI Cat# P0059 Choline Chloride Sigma Cat# C1879 Potassium Chloride Sigma Cat# P5405 Magnesium Chloride hexahydrate Sigma Cat# M2393 Sodium Phosphate Monobasic Monohydrate Sigma Cat# S9638 Calcium Chloride Hexahydrate Sigma Cat# 21108 HEPES Sigma Cat# H4034 Sodium L-ascorbate Sigma Cat# A4034 D-glucose Sigma Cat# G7021 Sodium bicarbonate Sigma Cat# S5761 Sodium Pyruvate Sigma Cat# P5280 Fluoromount G Southern Biotech Cat# 0100-01 Lane marker reducing sample buffer Thermo Fisher Scientific Cat# 39000 Goat serum Life Technologies Cat# 16210072 Precision plus all blue protein standards BioRad Cat# 1610373 Critical commercial assays MACS Neural Tissue Dissociation Kit Miltenyi Cat# 130-092-628 MACS Anti-ACSA-2 Microbead kit Miltenyi Cat# 130-097-678 MACS Myelin Removal Microbead kit Miltenyi Cat# 130-104-257 Miltenyi Cd11b Microbeads Kit Miltenyi Cat# 130-093-634 Neuron Isolation Kit Miltenyi Cat# 130-115-389 Qubit Protein Assay Kit Invitrogen Cat# Q33211 InFusion HD Cloning Kit Takara Cat# 638909 NucleoSpin Gel and PCR Cleanup Kit Macherey-Nagel Cat# 740609.50 Endotoxin free plasmid MAXI kit Qiagen Cat# 12362 RNAScope Fluorescent Multiplex Detection Kit v1 ACD Cat# 320851 RNAScope Fluorescent Multiplex Detection Kit v2 ACD Cat# 323100 Experimental models: Organisms/strains Tg(Aldh1l1-EGFP)OFC789Gsat/Mmucd MMRRC Stock# 011-015UCD; RRID: MMRRC_011015-UCD Ptn knockout T.F. .. Vogt, Princeton University NA B6EiC3Sn.BLiA-Ts(1716)65Dn/DnJ Jackson Laboratories Stock#005252; RRID: IMSR_JAX:005252 B6.Cg-Tg(Thy1-YFP)HJrs/J Jackson Laboratories Stock#003782; RRID: IMSR_JAX:003782 Oligonucleotides Ptn-HA cloning forward ctcactataggctagcatg tcgtcccagcaatatca Integrated DNA Technologies N/A Pn-HA cloning reverse caggagaagatgctggatt atccgtatgatgttccggattatgcatagtctagagtcga Integrated DNA Technologies N/A smFP-HA cloning forward ctcactataggctag catgtacccttatgatgtgcccgattatgct Integrated DNA Technologies N/A smFP-HA cloning reverse gtacgatgtcccgga ctacgcttaatctagagtcgacccgg Integrated DNA Technologies N/A RNAScope Probe- Mm Ptn ACD Cat# 486381 RNAScope Probe- Mm Slc1a3-C2 ACD Cat# 430781-C2 (Continued on next page) 18 Cell Reports 44, 116300, October 28, 2025
Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
other:Article Title: Integrative characterization of MYC RNA-binding function.
Article Snippet: Mouse embryonic fibroblast cell line NIH/3T3 (CRL-1658) was obtained from the American Type Culture Collection (ATCC) and cultured in Dulbecco’s Modified Eagle Medium (DMEM, HyClone, SH30243.01) supplemented with 10% fetal bovine serum (FBS, Gibco, 10438-026), 1% MEM non-essential amino acids (Gibco, 11140-050), 10 mM HEPES (Gibco, 15630-080), and 1% penicillin/streptomycin (Corning, 30-002-CI).
Article Title: Structural and functional basis of mechanosensitive TMEM63 channelopathies.
Article Snippet: Article Structural and functional basis of mechanosensitive TMEM63 channelopathies Highlights • TMEM63B p.V44M is a gain-of-function mutation, evoking constitutive scramblase activity • Rearrangement of pore-lining helices opens a lateral lipid translocation cleft • p.V44M and other TMEM63A and -B disease mutations cluster around a hydrophobic latch • Hydrophobic latch may be involved in TMEM63 channelopathies and force-induced activation Authors Wang Zheng, Augustus J. Lowry, Harper E. Smith, ..., Tian-Min Fu, Huanghe Yang, Jeffrey R. Holt Correspondence wzheng86@wisc.edu (W.Z.), jeffrey.holt@childrens.harvard.edu (J. R.H.) In brief Zheng et al. reveal that disease-causing mutations in mechanosensitive TMEM63 ion channels elicit constitutive lipid scramblase activity by opening a lateral lipid translocation cleft.. The force- induced activation of TMEM63s is proposed to be mediated by a hydrophobic latch, sensing membrane thickness.. Zheng et al., 2025, Neuron 113, 1–16 August 6, 2025 © 2025 Elsevier Inc. All rights are reserved, including those for text and data mining, AI training, and similar technologies. https://doi.org/10.1016/j.neuron.2025.05.009 ll
Article Title: Genetic variants affecting NQO1 protein levels impact the efficacy of idebenone treatment in Leber hereditary optic neuropathy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NQO1 Thermo fisher Scientific Cat#39–3700, clone A180; RRID: AB_2533410 Anti-ACTIN Sigma-Aldrich Cat#SAB5500001, clone SP124 Anti-GAPDH Sigma-Aldrich Cat#G8795; RRID:AB_1078991 Rabbit anti-MAP2 Cell Signaling Technology Cat# 4542, RRID:AB_10693782 Rabbit anti-bIIITUBULIN Cell Signaling Technology Cat# 5568, RRID:AB_10694505 Mouse anti-GFAP Millipore Cat# MAB360, RRID:AB_11212597 Goat anti-Rabbit IgG Alexa Fluor 488 Thermo Fisher Scientific Cat# A-11034, RRID:AB_2576217 Goat anti-Mouse IgG Alexa Fluor 546 Thermo Fisher Scientific Cat# A-11030, RRID:AB_2534089 Hoechst 33342 Invitrogen Cat#H1399 Chemicals, peptides, and recombinant proteins Idebenone Santhera Pharmaceuticals Gift H2DCFDA Thermo fisher Scientific Cat#D399 Sulforhodamine B (SRB) Merck Cat#S1402 Dicoumarol Sigma-Aldrich 287897 N-acetyl-cysteine (NAC) Sigma-Aldrich A7250 Critical commercial assays Seahorse XFe Cell Mito Stress Test Kit Seahorse Bioscience Cat#102340-100 Seahorse XFe96 FluxPak mini Seahorse Bioscience Cat#102601-100 XF medium pH 7.4 Seahorse Bioscience Cat#103575-100 CyQuant Direct Cell Proliferation Assay Kit Life Technologies Cat#C35011 Lentiviral Packaging Kit Origene Cat#TR30037 Nextera XT DNA Library Preparation Kit (96 samples) Illumina Cat#FC-131-1096 Nextera XT Index Kit v2 Set A (96 indexes, 384 samples) Illumina Cat#FC-131-2001 MiSeq Reagent Kit v2 (300-cycles) Illumina Cat#MS-102-2002 SNaPshot Multiplex Kit Applied Biosystems Cat#4323159 NucleoSpin Tissue, Mini kit for DNA MACHEREY-NAGEL Cat#740952 Qubit 1X dsDNA HS Assay Kit Invitrogen Cat#Q33231 SureSelect Human All Exon V5/V6 kits Agilent Technologies Cat#5190-8863 Pure Link RNA mini kit Thermo Fisher Scientific Cat#12183018A SuperScriptTM VILOTM cDNA Synthesis Kit Thermo Fisher Scientific Cat#11754050 LightCycler 480 SYBR Green I Roche Cat# 04887352001 Deposited data Human reference genome NCBI build 37, GRCh37 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/projects/ genome/assembly/grc/human/ Genome Aggregation Database (gnomAD) v2.1.1 Broad Institute http://gnomad.broadinstitute.org/; RRID:SCR_014964 Experimental models: Cell lines Skin fibroblasts (control, carrying the 3460/ND1 or the 11778/ND4 mutation) This paper N/A Wild-type and 3460/ND1 cybrids This paper, Strobe et al.,65 and Ghelli et al.66 N/A (Continued on next page) Cell Reports Medicine 5, 101383, February 20, 2024 e1
SYBR Green Assay:Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Single Cell:Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Library Quantification:Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Microarray:Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Software:Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
Indirect Immunoperoxidase Assay:Article Title: ESC models of autism with copy-number variations reveal cell-type-specific translational vulnerability.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GFP Monoclonal Antibody (3E6) Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11120; RRID: AB_221568 Tuj1 Monoclonal Antibody (Poly18020) Biolegend Purified anti-Tubulin β-3 (TUBB3) Antibody (Previously Covance catalog# PRB-435P); RRID: AB_2564645, Cat# 802001 Goat anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11029; RRID: AB_2534088 Goat anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Thermo Fisher Scientific Cat# A-11034; RRID: AB_2576217 Chemicals, Peptides, and Recombinant Proteins Dulbecco’s modified Eagle’s medium (DMEM) Thermo Fisher Scientific Cat # 11965092 Glasgow minimum essential medium (GMEM) Sigma Cat# G5154 GibcoTM Fetal Bovine Serum, qualified Thermo Fisher Scientific Cat# 10270-106 KnockOut Serum Replacement (KSR) Thermo Fisher Scientific Cat# 10828028 NeuroCult NSC Basal Medium STEMCELL Technologies Cat# 05700 L-glutamine Thermo Fisher Scientific Cat# 25030149 MEM Non-Essential Amino Acids Solution Thermo Fisher Scientific Cat# 11140076 Adenosine Sigma Cat# A9251 Cytidine Sigma Cat# C4654 Guanosine Sigma Cat# G6752 Thymidine Sigma Cat# T1895 Uridine Sigma Cat# U3750 2-Mercaptoethanol Sigma Cat# M3148 ESGRO Recombinant Mouse LIF Protein Millipore Cat# ESG1107 ACTH (1–24) Bachem Cat# 4059984 G418 Disulfate Aqueous Solution NACALAI TESQUE Cat# 09380-86 B27 supplement Thermo Fisher Scientific Cat# 17504044 Retinoic acid Sigma R2625 Recombinant Human/Murine/Rat BDNF Peprotech Cat# 450-02 Recombinant Human GDNF Peprotech Cat# 450-10 L(+)-Ascorbic Acid, Animal-Free Nakalai tesque Cat# 13048-42 Dibutyryl cAMP sodium salt Sigma Cat# D0627 Taq DNA Polymerase (NEB) NEB Cat# M0273 Flurothyl (bis(2,2,2-trifluoroethyl) ether) Tokyo Chemical Industry (TCI) Cat# B1293 Critical Commercial Assays Lipofectamine LTX Reagent with PLUS Reagent Thermo Fisher Scientific Cat# 15338100 VECTASHIELD Mounting Medium with DAPI Vector Laboratories Cat# H-1200 FluorSave Reagent Sigma Cat# 345789 Fluo-4, AM, cell permeant Thermo Fisher Scientific Cat# F14201 PCR DIG Probe Synthesis Kit Sigma Cat# 11636090910 (Continued on next page) Cell Genomics 5, 100877, June 11, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER SuperScript II Reverse Transcriptase Thermo Fisher Scientific Cat# 18064022 Fast SYBR Green Master Mix Thermo Fisher Scientific Cat# 4385610 Chromium Single Cell 3′ Library and Gel Bead Kit v.2 10X Genomics Cat# PN-120237 Agilent High Sensitivity DNA Agilent technologies Cat# 5067-4627 KAPA Library Quantification Kits - Complete Kit (universal) Roche Cat# 07960140001 Mouse Embryonic Stem Cell Nucleofector Kit Lonza Cat# VPH-1001 Neuron isolation kit, mouse Miltenyi Biotec Cat# 130-115-389 LS Columns Miltenyi Biotec Cat# 130-042-401 RNAscope(R) Multiplex Fluorescent Reagent Kit v2 with TSA Vivid Dyes ADC Cat# 323270 RNAscope Target Probe-Mm-Upf3b-C1 ADC Cat# 1291201-C1 SurePrint G3 Mouse CGH Microarray Kit, 1 × 1M Agilent technologies Cat# G4824A Recombinant DNA pX330-U6-Chimeric_BB-CBhhSpCas9 (pX330) Addgene http://www.addgene.org/42230; RRID: Addgene_42230 DT-A/loxP/PGK-Neo-pA/loxP RIKEN BDR Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research ID# 09 Experimental models: Cell lines CMTI-2 ESGRO Complete Adapted C57/BL6 male Mouse ES Cell Line Millipore Cat# SF-CMTI-2 Software and algorithms WIS-NeuroMath Rishal et al., 201388 https://www.weizmann.ac.il/vet/IC/ software/wis-neuromath; RRID:SCR_014481 MetaMorph Molecular Devices http://www.moleculardevices.com/ Products/Software/Meta-Imaging-Series/ MetaMorph.html; RRID:SCR_002368 TimeOFCR4 O’hara https://ohara-time.co.jp/category/ products/ TimeYM2 O’hara https://ohara-time.co.jp/category/ products/ TimeCSI1 O’hara https://ohara-time.co.jp/category/ products/ SASLab Pro Avisoft Bioacoustics http://www.avisoft.com/sound-analysis/ Cell Ranger v2.1.1 10X Genomics https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger; RRID:SCR_017344 Loupe Browser v.2.0.0 10X Genomics https://support.10xgenomics.com/ single-cell-gene-expression/software/ visualization/latest/what-is-loupe-cellbrowser; RRID:SCR_018555 Metascape Zhou et al., 201989 http://metascape.org/gp/index.html#/ main/step1; RRID:SCR_016620 ToppGene Suite Chen et al., 200948 http://toppgene.cchmc.org/; RRID:SCR_005726 Ingenuity Pathway Analysis (IPA) QIAGEN http://www.ingenuity.com/products/ pathways_analysis.html; RRID:SCR_008653 (Continued on next page) e2 Cell Genomics 5, 100877, June 11, 2025 .. CMTI-2 mouse embryonic stem cell line (derived from murine strain C57BL/6J, normal male genotype, Millipore) and their derivatives were used for all experiments. mESCs were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with ESqualified 15% FBS, 2 mM L-glutamine (Gibco), 0.1 mM MEM nonessential amino acids (NEAA, Gibco), nucleoside (Adenosine, Guanosine, Cytidine, Uridine, and Thymidine 30 μM each, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 1,000 IU/mL LIF (ESGRO, Millipore) on mitomycin C-treated mouse embryonic fibroblasts (MEF) feeder cells.
Membrane:Article Title: Structure of the MIWI endoribonuclease bound to pachytene piRNAs from mouse testes.
Article Snippet: Cas9 Nuclease V3 IDT Cat. No. 1081058 IDTE pH 7.5 (1× TE Solution) IDT Cat. No. 11-05-01-05 PierceTM Protease Inhibitor Tablets, EDTAfree Thermo Fisher Cat. no. A32965 OCT Embedding Matrix for Frozen Section VWR Cat. no. 361603E RiboLock RNase Inhibitor Thermo Fisher Cat. no. EO0381 Chloroform Merck Cat. no. 102445 (Continued on next page) 14 Cell Reports 45, 116804, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER GeneRuler 1kb DNA ladder Thermo Fisher Cat. no. SM0311 GlycoBlueTM Coprecipitant Thermo Fisher Cat. no. AM9515 Amersham Protran 0.45 mm Nitrocellulose Membrane GE Healthcare Cat. no. 10600002 Amersham Hyperfilm ECL GE Healthcare Cat. no. 28906837 Critical Commercial Assays/Kits NEBNext® Multiplex Small RNA Library Prep Set for Illumina® NEB Cat. No. E7300 MinElute Gel Extraction Kit Qiagen Cat. No. 28604 QIAquick PCR Purification Kit Qiagen Cat. No. 28106 Illustra MicroSpin G-25 micro columns, GE Healthcare Cat. No. 27-5325-01 Allprep DNA/RNA Micro Kit Qiagen Cat. No. 80284 MEGAshortscriptTM T7 Transcription Kit Life technologies Cat. no. AM1354 Deposited Data All raw gel and imaging data are deposited at Mendeley Data. .. This study Mendeley Data: https://doi.org/10.17632/ 3grbh5s2zh.1 Mass spectrometry data This study See Table S2 PRIDE: PXD071431 Deep sequencing datasets This study.
Purification:Article Title: Structure of the MIWI endoribonuclease bound to pachytene piRNAs from mouse testes.
Article Snippet: Cas9 Nuclease V3 IDT Cat. No. 1081058 IDTE pH 7.5 (1× TE Solution) IDT Cat. No. 11-05-01-05 PierceTM Protease Inhibitor Tablets, EDTAfree Thermo Fisher Cat. no. A32965 OCT Embedding Matrix for Frozen Section VWR Cat. no. 361603E RiboLock RNase Inhibitor Thermo Fisher Cat. no. EO0381 Chloroform Merck Cat. no. 102445 (Continued on next page) 14 Cell Reports 45, 116804, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER GeneRuler 1kb DNA ladder Thermo Fisher Cat. no. SM0311 GlycoBlueTM Coprecipitant Thermo Fisher Cat. no. AM9515 Amersham Protran 0.45 mm Nitrocellulose Membrane GE Healthcare Cat. no. 10600002 Amersham Hyperfilm ECL GE Healthcare Cat. no. 28906837 Critical Commercial Assays/Kits NEBNext® Multiplex Small RNA Library Prep Set for Illumina® NEB Cat. No. E7300 MinElute Gel Extraction Kit Qiagen Cat. No. 28604 QIAquick PCR Purification Kit Qiagen Cat. No. 28106 Illustra MicroSpin G-25 micro columns, GE Healthcare Cat. No. 27-5325-01 Allprep DNA/RNA Micro Kit Qiagen Cat. No. 80284 MEGAshortscriptTM T7 Transcription Kit Life technologies Cat. no. AM1354 Deposited Data All raw gel and imaging data are deposited at Mendeley Data. .. This study Mendeley Data: https://doi.org/10.17632/ 3grbh5s2zh.1 Mass spectrometry data This study See Table S2 PRIDE: PXD071431 Deep sequencing datasets This study.
Imaging:Article Title: Structure of the MIWI endoribonuclease bound to pachytene piRNAs from mouse testes.
Article Snippet: Cas9 Nuclease V3 IDT Cat. No. 1081058 IDTE pH 7.5 (1× TE Solution) IDT Cat. No. 11-05-01-05 PierceTM Protease Inhibitor Tablets, EDTAfree Thermo Fisher Cat. no. A32965 OCT Embedding Matrix for Frozen Section VWR Cat. no. 361603E RiboLock RNase Inhibitor Thermo Fisher Cat. no. EO0381 Chloroform Merck Cat. no. 102445 (Continued on next page) 14 Cell Reports 45, 116804, January 27, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER GeneRuler 1kb DNA ladder Thermo Fisher Cat. no. SM0311 GlycoBlueTM Coprecipitant Thermo Fisher Cat. no. AM9515 Amersham Protran 0.45 mm Nitrocellulose Membrane GE Healthcare Cat. no. 10600002 Amersham Hyperfilm ECL GE Healthcare Cat. no. 28906837 Critical Commercial Assays/Kits NEBNext® Multiplex Small RNA Library Prep Set for Illumina® NEB Cat. No. E7300 MinElute Gel Extraction Kit Qiagen Cat. No. 28604 QIAquick PCR Purification Kit Qiagen Cat. No. 28106 Illustra MicroSpin G-25 micro columns, GE Healthcare Cat. No. 27-5325-01 Allprep DNA/RNA Micro Kit Qiagen Cat. No. 80284 MEGAshortscriptTM T7 Transcription Kit Life technologies Cat. no. AM1354 Deposited Data All raw gel and imaging data are deposited at Mendeley Data. .. This study Mendeley Data: https://doi.org/10.17632/ 3grbh5s2zh.1 Mass spectrometry data This study See Table S2 PRIDE: PXD071431 Deep sequencing datasets This study.
Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
Reverse Transcription Polymerase Chain Reaction:Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
Cell Viability Assay:Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
Gene Knockout:Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
Countercurrent Chromatography:Article Title: The HDL-transporting scavenger receptor B1 promotes viral infection through endolysosomal acidification
Article Snippet: ArticleiScience
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
